Spotting Variants in Sequence Data
When inspecting aligned sequences, you may notice positions where some reads differ from others. These could be sequencing errors (random, scattered) or real variants like SNPs (consistent, appearing in a subset of reads). This tutorial shows how to use nanalogue's sequence visualization to spot these patterns visually. We'll first see what random errors look like, then contrast with a cleaner variant pattern where only some reads carry the difference.
Key Concept
When viewing many reads across a short region (10-20bp) with --full-region, all sequences align to the same length.
Random errors scatter across positions.
A real variant appears as a vertical column where a subset of reads consistently shows a different base.
Prerequisites
You will need:
- A BAM file with modification tags (
MMandMLtags) - Nanalogue installed
- For this tutorial: test data with simulated mismatches (configurations provided below)
Please read the Extracting sequences tutorial first, as this tutorial builds on those concepts.
Note: The contig names
contig_00001, etc. are example names used throughout this guide. In real BAM files aligned to a reference genome, you will see names likechr1,chr2,NC_000001.11, or similar depending on your reference.
What Random Errors Look Like
First, let's see what data looks like when all reads have random mismatches scattered throughout. This simulates sequencing errors or very noisy data.
nanalogue read-table-show-mods --tag m --region contig_00001:90-110 \
--seq-region contig_00001:90-110 --full-region error_data.bam
Example output:
# mod-unmod threshold is 0.5
read_id align_length sequence_length_template alignment_type mod_count sequence
0.337a590a-04bb-443e-8ea1-0a3dd9749112 200 200 supplementary_forward m:31 GGTACAATCCGATGCAACTA
0.930fcb84-5c0a-4f59-86b6-e0069f13ceb7 200 200 primary_forward m:33 CTATTCTCTCTCTCTTAATT
0.62dcc8b7-d6a1-4853-b40c-2a3c45a6f116 200 200 secondary_forward m:33 GTTACGACCCGATGGTTGTT
0.f00e2a1e-7cf3-426d-a559-740fd8661daf 200 200 supplementary_reverse m:37 TTTAGTTTATGAAGGACGTT
0.2ba9f7c3-13e9-4723-9854-0c5a80538a52 200 200 primary_forward m:29 AGGAGGACGTTAAACTTCTA
0.94f3d1c7-33de-45ca-bb5b-154bd7ddc9d0 200 200 primary_forward m:30 ATTCGCTTATAAAACACCCG
0.d055550c-6bf2-472d-9e0c-0297df5391f9 200 200 supplementary_forward m:29 CTTTTCGTATCATGAGACCC
0.9ed07340-11b4-4b0e-9055-66ea0e4da96a 200 200 secondary_forward m:34 GGTACTAGACCAATCGGCTA
0.12a294b9-222d-47c6-9b68-35e31e60a219 200 200 secondary_reverse m:33 GAAGGTACCGAAGGAAACAC
Notice how the mismatches are distributed randomly across positions. No single column shows a consistent pattern. If you were looking for a real variant, you wouldn't find a clear signal here - just noise.
Spotting a Consistent Variant
Now let's look at data where only some reads have mismatches - simulating a heterozygous-like variant. This test data has two groups of reads: one clean, one with mismatches.
nanalogue read-table-show-mods --tag m --region contig_00001:90-110 \
--seq-region contig_00001:90-110 --full-region variant_data.bam
Example output:
# mod-unmod threshold is 0.5
read_id align_length sequence_length_template alignment_type mod_count sequence
0.fa2fb3e5-a2bb-44a5-82fc-0bacc07d7c57 200 200 supplementary_reverse m:35 CTTGTCACTTGGGGGCAAGG
1.70634869-5b0c-4745-b0b7-a877144a186b 200 200 primary_forward m:30 ACCGTCACGTTATGGCGGCC
0.587ff0f4-46c8-49d5-9b8a-e09ff3aeb943 200 200 supplementary_reverse m:35 CTTGTCACTTGGGGGCAAGG
0.f4c791d5-f223-4923-abd8-f866dcf76f43 200 200 secondary_forward m:35 CTTGTCACTTGGGGGCAAGG
0.853b6de5-e4b4-4fc4-a1e2-810492c76fed 200 200 primary_forward m:35 CTTGTCACTTGGGGGCAAGG
1.67afe3c4-624f-4263-b5d5-f65b71cbba4d 200 200 secondary_reverse m:40 GTTGTGACCAAGGCGTAAGC
1.bacb8ed5-cdbb-4d61-949a-29772ee8979b 200 200 secondary_reverse m:34 GTTAGGCTACTGGCGCCGGG
1.aa87f8c2-d4eb-45fe-9aa0-809cb534e181 200 200 secondary_forward m:30 CTTGTATTGGGGAGCCAGGG
1.4616177c-4ab4-4292-acc7-24c634de27d0 200 200 secondary_reverse m:35 GTTTACAGGCTGGAGTGAGA
1.c779961e-0d5b-448b-8aa1-692b3486aa78 200 200 secondary_forward m:36 TAGGTAAATTCCATGCTATG
0.2b5c2290-7587-4492-bd89-9149790ab236 200 200 primary_forward m:35 CTTGTCACTTGGGGGCAAGG
0.ebe40ffa-d883-4e57-b5b0-fa728d481e8b 200 200 supplementary_reverse m:35 CTTGTCACTTGGGGGCAAGG
1.2603e53e-4a5d-4237-8beb-cd6b6a99e683 200 200 supplementary_forward m:35 CGTGTTAAGTAAGGGGACAG
1.5a7d129e-9ecd-4a4b-9024-aadfe45db632 200 200 supplementary_reverse m:32 ATGGGTATTGACGTGTCAGG
1.0355700d-abe6-446e-a9dc-ebad37f0b0bd 200 200 supplementary_reverse m:30 CTAGCCCGTTATGATCAGGC
1.aca9bf96-0175-42c3-a4d9-7b07aee69561 200 200 secondary_forward m:30 CTAATCGTTATAGTGCACGG
0.3b8f2657-64c0-40dc-83d5-0097223f24dd 200 200 primary_reverse m:35 CTTGTCACTTGGGGGCAAGG
0.fe9b97f8-412b-497f-b24a-478bdeac3fb2 200 200 primary_reverse m:35 CTTGTCACTTGGGGGCAAGG
0.5b91b2dc-c6ba-439e-862b-f4dc85d29f2b 200 200 supplementary_forward m:35 CTTGTCACTTGGGGGCAAGG
1.96e2c65c-9b28-4431-861e-270e3f349145 200 200 secondary_forward m:32 CGGTAGTCTCGGAGTAAGGA
Compare the read IDs to the sequences. The reads with IDs starting with "1." carry mismatches while those starting with "0." are clean.
Important: This ID-based grouping exists only because we created the test data this way. In real datasets, read IDs have no relationship to sequence features. However, the visual pattern remains the same: a subset of reads consistently differing at certain positions. That's the visual signature of a potential variant.
Unlike the random noise in the previous section, here we see structure. This is closer to what a real heterozygous variant looks like - consistent differences in a subset of reads.
Combining Variant and Modification Views
Add --show-mod-z to see modifications marked alongside the base differences:
nanalogue read-table-show-mods --tag m --region contig_00001:90-110 \
--seq-region contig_00001:90-110 --full-region --show-mod-z variant_data.bam
Example output:
# mod-unmod threshold is 0.5
read_id align_length sequence_length_template alignment_type mod_count sequence
1.5a7d129e-9ecd-4a4b-9024-aadfe45db632 200 200 supplementary_reverse m:32 ATGZZTATTZACZTZTCAGG
0.5b91b2dc-c6ba-439e-862b-f4dc85d29f2b 200 200 supplementary_forward m:35 ZTTGTCACTTGGGGGCAAGG
1.70634869-5b0c-4745-b0b7-a877144a186b 200 200 primary_forward m:30 AZZGTCACGTTATGGCGGZZ
0.f4c791d5-f223-4923-abd8-f866dcf76f43 200 200 secondary_forward m:35 ZTTGTCACTTGGGGGCAAGG
1.aa87f8c2-d4eb-45fe-9aa0-809cb534e181 200 200 secondary_forward m:30 ZTTGTATTGGGGAGZZAGGG
1.2603e53e-4a5d-4237-8beb-cd6b6a99e683 200 200 supplementary_forward m:35 ZGTGTTAAGTAAGGGGAZAG
0.fe9b97f8-412b-497f-b24a-478bdeac3fb2 200 200 primary_reverse m:35 CTTGTCACTTGZZZZCAAZG
1.96e2c65c-9b28-4431-861e-270e3f349145 200 200 secondary_forward m:32 ZGGTAGTZTZGGAGTAAGGA
1.4616177c-4ab4-4292-acc7-24c634de27d0 200 200 secondary_reverse m:35 ZTTTACAZGCTGGAZTZAZA
1.bacb8ed5-cdbb-4d61-949a-29772ee8979b 200 200 secondary_reverse m:34 GTTAZZCTACTZZCZCCGGG
0.587ff0f4-46c8-49d5-9b8a-e09ff3aeb943 200 200 supplementary_reverse m:35 CTTGTCACTTGZZZZCAAZG
0.3b8f2657-64c0-40dc-83d5-0097223f24dd 200 200 primary_reverse m:35 CTTGTCACTTGZZZZCAAZG
1.0355700d-abe6-446e-a9dc-ebad37f0b0bd 200 200 supplementary_reverse m:30 CTAZCCCZTTATZATCAGGC
0.ebe40ffa-d883-4e57-b5b0-fa728d481e8b 200 200 supplementary_reverse m:35 CTTGTCACTTGZZZZCAAZG
0.853b6de5-e4b4-4fc4-a1e2-810492c76fed 200 200 primary_forward m:35 ZTTGTCACTTGGGGGCAAGG
0.2b5c2290-7587-4492-bd89-9149790ab236 200 200 primary_forward m:35 ZTTGTCACTTGGGGGCAAGG
1.c779961e-0d5b-448b-8aa1-692b3486aa78 200 200 secondary_forward m:36 TAGGTAAATTZZATGCTATG
1.67afe3c4-624f-4263-b5d5-f65b71cbba4d 200 200 secondary_reverse m:40 GTTGTZACCAAZZCZTAAZC
0.fa2fb3e5-a2bb-44a5-82fc-0bacc07d7c57 200 200 supplementary_reverse m:35 CTTGTCACTTGZZZZCAAZG
1.aca9bf96-0175-42c3-a4d9-7b07aee69561 200 200 secondary_forward m:30 ZTAATZGTTATAGTGZAZGG
This combined view lets you inspect whether variants occur near modified bases. In some biological contexts, SNPs can affect modification patterns - or a variant at a modified position might affect how the modification is called. Visual inspection gives you a quick sanity check before deeper analysis.
Note: Modifications at variant positions may be less reliable since the basecaller's modification model may assume the reference base.
Interpreting What You See
Patterns to look for:
- Consistent column differences in a subset of reads → potential variant worth investigating
- Scattered differences across positions → likely sequencing errors or very noisy data
- Single read with many differences → possible alignment issue or sample contamination
Limitations:
- Visual inspection works for quick exploration, not rigorous variant calling
- High coverage helps - with few reads, random errors can look like variants
- Short regions (10-20bp) work best for this approach; longer regions become hard to scan visually
What to do next:
For rigorous SNP detection and genotyping, use specialized variant calling tools. Nanalogue's strength is quick visual inspection - useful for QC, sanity checks, or exploring specific regions of interest.
Creating Test Data
To create your own test BAM files for this tutorial:
- Test data with random errors — All reads have scattered mismatches
- Test data with variants — Two read groups simulating heterozygous-like pattern
Next Steps
- Extracting sequences — More sequence display options
- Quality control of mod data — Assess modification call quality
- Finding highly modified reads — Filter reads by modification level
See Also
- Quick look at your data — Initial data inspection
- CLI Reference — Full documentation of all nanalogue commands
- Recipes — Quick copy-paste snippets